Detail of EST/Unigene BI308411 |
Acc. | BI308411 |
Internal Acc. | EST529821 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Seed linoleate 9S-lipoxygenase-2 OS=Pisum sativum E-value=0; Seed linoleate 9S-lipoxygenase-2 OS=Glycine max E-value=0; Seed linoleate 13S-lipoxygenase-1 OS=Glycine max E-value=0; Seed linoleate 9S-lipoxygenase-3 OS=Glycine max E-value=0; Seed linoleate 9S-lipoxygenase-3 OS=Pisum sativum E-value=0; |
Length | 821 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | GCGCATTCGAATCTGCATTTGATTTGAATTTTACACCGCGCGAGTTTGATAGTTTCCAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08021 arachidonate 12-lipoxygenase (R-type); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08022 arachidonate 15-lipoxygenase (second type) / 8-lipoxygenase (S-type) |
EC | 1.13.11.- 1.13.11.33 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841944 |
Trichome-related Gene from Literature | 841944 |