Detail of EST/Unigene BI308717 |
Acc. | BI308717 |
Internal Acc. | EST530127 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 89A2 OS=Arabidopsis thaliana E-value=3e-52; Cytochrome P450 89A9 OS=Arabidopsis thaliana E-value=4e-41; Cytochrome P450 77A3 OS=Glycine max E-value=1e-22; Cytochrome P450 77A2 OS=Solanum melongena E-value=7e-21; Cytochrome P450 77A4 OS=Arabidopsis thaliana E-value=4e-19; |
Length | 598 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | CTATTAAGGTTATGCCACACTTCAAATATGCTATGTTCTCTTTACTTGTTTTTATGTGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815688 |
Trichome-related Gene from Literature | N/A |