| Detail of EST/Unigene BI309070 |
| Acc. | BI309070 |
| Internal Acc. | EST530480 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase large chain OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=6e-62; Carbamoyl-phosphate synthase large chain OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=6e-61; Carbamoyl-phosphate synthase large chain OS=Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88) E-value=4e-49; Carbamoyl-phosphate synthase large chain OS=Zymomonas mobilis (strain ATCC 31821 / ZM4 / CP4) E-value=5e-49; Carbamoyl-phosphate synthase large chain OS=Methanoregula boonei (strain 6A8) E-value=5e-49; |
| Length | 570 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD; |
| Sequence | GGGGAGGTCAAACACCACTGAAACTAGCTCTCCCTCTACAACGATACCTAGATGAACACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01948 carbamoyl-phosphate synthase (ammonia) |
| EC | 6.3.4.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839868 |
| Trichome-related Gene from Literature | N/A |