Detail of EST/Unigene BI309249 |
Acc. | BI309249 |
Internal Acc. | EST530659 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase 2 OS=Nicotiana tabacum E-value=1e-72; 4-coumarate--CoA ligase 1 OS=Nicotiana tabacum E-value=6e-72; 4-coumarate--CoA ligase 2 OS=Solanum tuberosum E-value=2e-71; 4-coumarate--CoA ligase 1 OS=Solanum tuberosum E-value=2e-71; 4-coumarate--CoA ligase 1 OS=Petroselinum crispum E-value=1e-69; |
Length | 590 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | GCAGATGAGAATGATCATCTTCCTGATGCAAAGATCCAGCCAGACGATGTTGTTGCGCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K08748 solute carrier family 27 (fatty acid transporter), member 5 |
EC | 6.2.1.12 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
Probeset |
|
Corresponding NCBI Gene | 841593 |
Trichome-related Gene from Literature | 841593 |