| Detail of EST/Unigene BI309262 |
| Acc. | BI309262 |
| Internal Acc. | EST530672 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | UTP--glucose-1-phosphate uridylyltransferase OS=Astragalus penduliflorus E-value=9e-77; UTP--glucose-1-phosphate uridylyltransferase OS=Pyrus pyrifolia E-value=1e-67; UTP--glucose-1-phosphate uridylyltransferase OS=Solanum tuberosum E-value=2e-65; UTP--glucose-1-phosphate uridylyltransferase OS=Musa acuminata E-value=6e-65; UTP--glucose-1-phosphate uridylyltransferase OS=Hordeum vulgare E-value=3e-64; |
| Length | 592 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD; |
| Sequence | GCACATTTGCATCTTCCTTTCTCTCTAGAATCTTCCATCGCCAATGGCTACCGCTACCGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase |
| EC | 2.7.7.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831596 |
| Trichome-related Gene from Literature | N/A |