Detail of EST/Unigene BI309274 |
Acc. | BI309274 |
Internal Acc. | EST530684 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | S-adenosylmethionine synthase OS=Medicago truncatula E-value=1e-17; S-adenosylmethionine synthase OS=Brassica rapa subsp. pekinensis E-value=4e-17; S-adenosylmethionine synthase 5 OS=Brassica juncea E-value=4e-17; S-adenosylmethionine synthase 3 OS=Brassica juncea E-value=4e-17; S-adenosylmethionine synthase 1 OS=Brassica juncea E-value=4e-17; |
Length | 129 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | ATGTAGACTATGAGAAGATCGTTCGCGACACATGCCGCACCATTGGATTCATCTCTGATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00789 S-adenosylmethionine synthetase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00789 S-adenosylmethionine synthetase |
EC | 2.5.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826987 |
Trichome-related Gene from Literature | N/A |