| Detail of EST/Unigene BI309654 |
| Acc. | BI309654 |
| Internal Acc. | EST531064 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin F-type, chloroplastic OS=Pisum sativum E-value=8e-55; Thioredoxin F2, chloroplastic OS=Arabidopsis thaliana E-value=2e-46; Thioredoxin F1, chloroplastic OS=Arabidopsis thaliana E-value=9e-46; Thioredoxin F-type, chloroplastic OS=Brassica napus E-value=6e-45; Thioredoxin F-type, chloroplastic OS=Mesembryanthemum crystallinum E-value=9e-44; |
| Length | 639 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD; |
| Sequence | AATGGCTCTTACTCTCTGCACCTCCCCTAAATGGATTGGCACCACCGTCTTTGATAGTAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831501 |
| Trichome-related Gene from Literature | N/A |