| Detail of EST/Unigene BI309697 |
| Acc. | BI309697 |
| Internal Acc. | EST531107 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cell division control protein 48 homolog E OS=Arabidopsis thaliana E-value=0; Cell division control protein 48 homolog D OS=Arabidopsis thaliana E-value=0; Cell division control protein 48 homolog A OS=Arabidopsis thaliana E-value=0; Cell division cycle protein 48 homolog OS=Glycine max E-value=0; Cell division cycle protein 48 homolog OS=Capsicum annuum E-value=0; |
| Length | 780 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD; |
| Sequence | ACCACTTTCTTCTTCTTCTTCCGCTATGGCGAATCAACCCGAATCCTCCGATGCTAAGGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K03061 26S proteasome regulatory subunit T1; Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K03063 26S proteasome regulatory subunit T3; Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K03064 26S proteasome regulatory subunit T4 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea) |
| Probeset |
|
| Corresponding NCBI Gene | 831870 |
| Trichome-related Gene from Literature | N/A |