Detail of EST/Unigene BI309697 |
Acc. | BI309697 |
Internal Acc. | EST531107 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cell division control protein 48 homolog E OS=Arabidopsis thaliana E-value=0; Cell division control protein 48 homolog D OS=Arabidopsis thaliana E-value=0; Cell division control protein 48 homolog A OS=Arabidopsis thaliana E-value=0; Cell division cycle protein 48 homolog OS=Glycine max E-value=0; Cell division cycle protein 48 homolog OS=Capsicum annuum E-value=0; |
Length | 780 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | ACCACTTTCTTCTTCTTCTTCCGCTATGGCGAATCAACCCGAATCCTCCGATGCTAAGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K03061 26S proteasome regulatory subunit T1; Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K03063 26S proteasome regulatory subunit T3; Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K03064 26S proteasome regulatory subunit T4 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea) |
Probeset |
|
Corresponding NCBI Gene | 831870 |
Trichome-related Gene from Literature | N/A |