Detail of EST/Unigene BI310480 |
Acc. | BI310480 |
Internal Acc. | EST5312230 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 9-cis-epoxycarotenoid dioxygenase NCED3, chloroplastic OS=Arabidopsis thaliana E-value=2e-08; 9-cis-epoxycarotenoid dioxygenase NCED2, chloroplastic OS=Arabidopsis thaliana E-value=4e-08; 9-cis-epoxycarotenoid dioxygenase NCED9, chloroplastic OS=Arabidopsis thaliana E-value=6e-08; 9-cis-epoxycarotenoid dioxygenase NCED1, chloroplastic OS=Phaseolus vulgaris E-value=8e-08; Probable 9-cis-epoxycarotenoid dioxygenase NCED5, chloroplastic OS=Arabidopsis thaliana E-value=2e-07; |
Length | 415 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD (1 ESTs); |
Sequence | TAAACGCTGTGGACTTGAAAGTGGAAGCTACCGTTAAGTTACCTTCTAGAGTGCCGTATG |
EST members of Unigene | BI310480 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.28691.1.S1_at
|
Corresponding NCBI Gene | 820667 |
Trichome-related Gene from Literature | N/A |