Detail of EST/Unigene BM778939 |
Acc. | BM778939 |
Internal Acc. | EST589514 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 20 OS=Arabidopsis thaliana E-value=3e-84; Probable beta-1,3-galactosyltransferase 17 OS=Arabidopsis thaliana E-value=1e-71; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=6e-71; Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=1e-68; Beta-1,3-galactosyltransferase 15 OS=Arabidopsis thaliana E-value=4e-37; |
Length | 675 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | GCTACATCTCTTCCTACTTCACACCCAAGTTTCTCACCTCAAAGAGTACTGGAAATGTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko00532 Chondroitin sulfate biosynthesis > K00734 galactosylxylosylprotein 3-beta-galactosyltransferase; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K00734 galactosylxylosylprotein 3-beta-galactosyltransferase; Metabolism > Glycan Biosynthesis and Metabolism > ko01031 Glycan structures - Biosynthesis 2 > K07819 beta-1,3-galactosyltransferase 1; Metabolism > Glycan Biosynthesis and Metabolism > ko00601 Glycosphingolipid biosynthesis - lacto and neolacto series > K07819 beta-1,3-galactosyltransferase 1 |
EC | 2.4.1.- 2.4.1.134 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827853 |
Trichome-related Gene from Literature | N/A |