Detail of EST/Unigene BM779083 |
Acc. | BM779083 |
Internal Acc. | EST589658 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Citrate synthase 4, mitochondrial OS=Arabidopsis thaliana E-value=2e-26; Citrate synthase, mitochondrial OS=Daucus carota E-value=8e-25; Citrate synthase, mitochondrial OS=Citrus maxima E-value=6e-24; Citrate synthase 5, mitochondrial OS=Arabidopsis thaliana E-value=3e-21; Citrate synthase, mitochondrial OS=Fragaria ananassa E-value=4e-20; |
Length | 394 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | TTTCTTTTCTCTTCTAGTATAAAGACCAGTTCAATTTTCCTATTTTTTTTGGATCCGTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.3.3.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819042 |
Trichome-related Gene from Literature | N/A |