| Detail of EST/Unigene BM779175 |
| Acc. | BM779175 |
| Internal Acc. | EST589750 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=1e-74; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=4e-64; Fructan 6-exohydrolase OS=Beta vulgaris E-value=1e-57; Beta-fructofuranosidase, insoluble isoenzyme CWINV5 OS=Arabidopsis thaliana E-value=4e-57; Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=2e-55; |
| Length | 552 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | TTATACACTGGGAATTTTCCCAATGAATCACCAAGTTCAAAATATAGCATACCCTAAAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820591 |
| Trichome-related Gene from Literature | N/A |