| Detail of EST/Unigene BM779269 |
| Acc. | BM779269 |
| Internal Acc. | EST589844 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 2-methylbutanal oxime monooxygenase OS=Manihot esculenta E-value=2e-23; Cytochrome P450 71B34 OS=Arabidopsis thaliana E-value=3e-22; Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=6e-22; Cytochrome P450 71B37 OS=Arabidopsis thaliana E-value=6e-22; Cytochrome P450 71B9 OS=Arabidopsis thaliana E-value=6e-22; |
| Length | 319 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | AACACAAAACATCTAAGAAATCAACAACTCTTCCACCAGGTCCTAAAGGCCTTCCTTTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07415 cytochrome P450, family 2, subfamily E |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822234 |
| Trichome-related Gene from Literature | N/A |