| Detail of EST/Unigene BM779277 |
| Acc. | BM779277 |
| Internal Acc. | EST589852 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A8 OS=Mentha piperita E-value=2e-61; Cytochrome P450 71A1 OS=Persea americana E-value=1e-59; Psoralen synthase (Fragment) OS=Apium graveolens E-value=2e-57; Cytochrome P450 71A23 OS=Arabidopsis thaliana E-value=1e-56; Psoralen synthase OS=Ammi majus E-value=1e-56; |
| Length | 541 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | CTAGGTTTTCCTATTGACAAACAGTCTTAAGGCCCTGTTATTGGACATGTTTTCTGCAGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
| EC | 1.14.14.1 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823988 |
| Trichome-related Gene from Literature | N/A |