Detail of EST/Unigene BM779457 |
Acc. | BM779457 |
Internal Acc. | EST590033 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=1e-67; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=2e-58; Fructan 6-exohydrolase OS=Beta vulgaris E-value=1e-51; Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=2e-51; Beta-fructofuranosidase, insoluble isoenzyme CWINV5 OS=Arabidopsis thaliana E-value=2e-50; |
Length | 504 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | TTCATGGTATCAACCAGCTATTTTATACCACTGGAATTGACCCAATGAATCACCAAGTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |