Detail of EST/Unigene BM779542 |
Acc. | BM779542 |
Internal Acc. | EST590118 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | DNA ligase 1 OS=Arabidopsis thaliana E-value=4e-56; DNA ligase 1 OS=Xenopus laevis E-value=7e-31; DNA ligase 1 OS=Mus musculus E-value=7e-31; DNA ligase 1 OS=Rattus norvegicus E-value=1e-29; DNA ligase 1 OS=Dictyostelium discoideum E-value=1e-29; |
Length | 531 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | CCGCCGAGCAAGATCCGAAACACATCATCATCTTCGAAGGGAATAGTCGCTGAATTGAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03410 Base excision repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10747 DNA ligase 1 |
EC | 6.5.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837333 |
Trichome-related Gene from Literature | N/A |