Detail of EST/Unigene BM779616 |
Acc. | BM779616 |
Internal Acc. | EST590192 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acyl-coenzyme A oxidase 4, peroxisomal OS=Arabidopsis thaliana E-value=0; Glutaryl-CoA dehydrogenase, mitochondrial OS=Dictyostelium discoideum E-value=2e-26; Probable glutaryl-CoA dehydrogenase, mitochondrial OS=Caenorhabditis elegans E-value=1e-25; Glutaryl-CoA dehydrogenase, mitochondrial OS=Macaca fascicularis E-value=4e-24; Glutaryl-CoA dehydrogenase, mitochondrial OS=Mus musculus E-value=8e-24; |
Length | 734 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | GCATTGTAATCTACTCAACATTTTATTGAATGCTTCTGTTTTACCAGTACTTATTAATTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00632 Benzoate degradation via CoA ligation > K00252 glutaryl-CoA dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00252 glutaryl-CoA dehydrogenase; Metabolism > Amino Acid Metabolism > ko00310 Lysine degradation > K00252 glutaryl-CoA dehydrogenase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K00252 glutaryl-CoA dehydrogenase |
EC | 1.3.99.7 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824347 |
Trichome-related Gene from Literature | N/A |