| Detail of EST/Unigene BM779648 |
| Acc. | BM779648 |
| Internal Acc. | EST590224 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Non-cyanogenic beta-glucosidase OS=Trifolium repens E-value=4e-71; Cyanogenic beta-glucosidase (Fragment) OS=Trifolium repens E-value=1e-70; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=1e-65; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=4e-65; Beta-glucosidase 27 OS=Oryza sativa subsp. japonica E-value=4e-64; |
| Length | 766 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | GATATCCCACGGCAGTCCCAATCAATGAGGAATGTGATCAGACCACCCCCTCCAAAGAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
| EC | 3.2.1.108 3.2.1.62 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820082 |
| Trichome-related Gene from Literature | N/A |