| Detail of EST/Unigene BM779702 |
| Acc. | BM779702 |
| Internal Acc. | EST590278 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyoxylate reductase OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) E-value=9e-41; Glyoxylate reductase OS=Pyrococcus kodakaraensis (strain ATCC BAA-918 / JCM 12380 / KOD1) E-value=7e-38; Glyoxylate reductase OS=Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1) E-value=9e-38; Glyoxylate reductase OS=Thermococcus onnurineus (strain NA1) E-value=2e-37; Glyoxylate reductase OS=Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3) E-value=4e-37; |
| Length | 715 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | ATGGAATCCATAGATGTTCTCCTCGTAGCTCAAGTACTCCCTTACTTAGAACAAGAACTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00015 glyoxylate reductase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00049 glyoxylate reductase (NADP+) |
| EC | 1.1.1.26 1.1.1.79 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844326 |
| Trichome-related Gene from Literature | N/A |