| Detail of EST/Unigene BM779901 |
| Acc. | BM779901 |
| Internal Acc. | EST590477 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Isocitrate dehydrogenase [NADP], chloroplastic (Fragment) OS=Medicago sativa E-value=5e-69; Isocitrate dehydrogenase [NADP] OS=Nicotiana tabacum E-value=4e-66; Isocitrate dehydrogenase [NADP] OS=Solanum tuberosum E-value=9e-66; Isocitrate dehydrogenase [NADP] OS=Glycine max E-value=2e-65; Isocitrate dehydrogenase [NADP], mitochondrial OS=Aspergillus niger E-value=1e-56; |
| Length | 685 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | GATCATCTTCATCATCACTGGTTTCGATTAACCAGCACTCTCACAATGCTATCTTCTTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00031 isocitrate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00031 isocitrate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00031 isocitrate dehydrogenase |
| EC | 1.1.1.42 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831311 |
| Trichome-related Gene from Literature | N/A |