Detail of EST/Unigene BM779934 |
Acc. | BM779934 |
Internal Acc. | EST590510 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glyoxylate reductase OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) E-value=2e-29; Glyoxylate reductase OS=Thermococcus litoralis E-value=5e-28; Glyoxylate reductase OS=Pyrococcus kodakaraensis (strain ATCC BAA-918 / JCM 12380 / KOD1) E-value=1e-27; Glyoxylate reductase OS=Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1) E-value=7e-27; Glyoxylate reductase OS=Thermofilum pendens (strain Hrk 5) E-value=2e-26; |
Length | 539 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | ATGGAATCCATAGATGTTCTCCTCGTAGCTCAAGTACTCCCTTACTTAGAACAAGAACTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00015 glyoxylate reductase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00058 D-3-phosphoglycerate dehydrogenase |
EC | 1.1.1.26 1.1.1.79 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844326 |
Trichome-related Gene from Literature | N/A |