Detail of EST/Unigene BM780074 |
Acc. | BM780074 |
Internal Acc. | EST590650 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional cystathionine gamma-lyase/cysteine synthase OS=Arabidopsis thaliana E-value=4e-16; Cysteine synthase OS=Brassica juncea E-value=6e-16; Cysteine synthase OS=Arabidopsis thaliana E-value=6e-16; Cysteine synthase OS=Solanum tuberosum E-value=1e-15; Cysteine synthase OS=Triticum aestivum E-value=1e-15; |
Length | 246 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | TAGCTTTTGGATCTTAAGGAAATCAACCTGGAAATTCCTGATTTTGCAGGCTTTCTTCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase |
EC | 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832872 |
Trichome-related Gene from Literature | N/A |