| Detail of EST/Unigene BM780099 |
| Acc. | BM780099 |
| Internal Acc. | EST590675 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | UTP--glucose-1-phosphate uridylyltransferase OS=Astragalus penduliflorus E-value=2e-83; UTP--glucose-1-phosphate uridylyltransferase OS=Hordeum vulgare E-value=7e-80; UTP--glucose-1-phosphate uridylyltransferase OS=Musa acuminata E-value=5e-79; Probable UTP--glucose-1-phosphate uridylyltransferase 2 OS=Arabidopsis thaliana E-value=6e-79; UTP--glucose-1-phosphate uridylyltransferase OS=Pyrus pyrifolia E-value=3e-78; |
| Length | 620 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | ATTTGTGGGTGAACTTGAAAGCAATCAAAAGACTTGTCGAAGCTGATGCTCTTAAGATGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase |
| EC | 2.7.7.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821313 |
| Trichome-related Gene from Literature | N/A |