| Detail of EST/Unigene BQ122587 |
| Acc. | BQ122587 |
| Internal Acc. | EST608163 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase 3 OS=Glycine max E-value=2e-49; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=6e-49; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=1e-48; Glutathione S-transferase U22 OS=Arabidopsis thaliana E-value=6e-48; Glutathione S-transferase U19 OS=Arabidopsis thaliana E-value=4e-47; |
| Length | 417 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD (1 ESTs); |
| Sequence | CCATGGCTGATGAAGTGATTCTGCTAGATTACTGGGTAAGTCCATTTGGCATGAGGGTCA |
| EST members of Unigene | BQ122587 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
| Probeset |
Msa.1237.1.S1_s_at
|
| Corresponding NCBI Gene | 844169 |
| Trichome-related Gene from Literature | N/A |