Detail of EST/Unigene BQ124952 |
Acc. | BQ124952 |
Internal Acc. | EST610528 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=1e-24; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=2e-24; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=4e-24; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=1e-23; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=4e-23; |
Length | 779 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD (1 ESTs); |
Sequence | CGTATCCGAAAAAATAAATATATTCCATGTGGTGGCATGTCATTCCGGGTTATTATCTTT |
EST members of Unigene | BQ124952 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.43698.1.S1_at
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |