| Detail of EST/Unigene BQ135363 |
| Acc. | BQ135363 |
| Internal Acc. | NF004C05EC1F1035 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribonucleoside-diphosphate reductase large subunit OS=Arabidopsis thaliana E-value=1e-12; Ribonucleoside-diphosphate reductase large subunit OS=Dictyostelium discoideum E-value=2e-12; Ribonucleoside-diphosphate reductase large subunit OS=Drosophila melanogaster E-value=2e-09; Ribonucleoside-diphosphate reductase large subunit OS=Pongo abelii E-value=2e-09; Ribonucleoside-diphosphate reductase large subunit OS=Mus musculus E-value=2e-09; |
| Length | 855 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL (1 ESTs); |
| Sequence | TGATACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
| EST members of Unigene | BQ135363 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K10807 ribonucleoside-diphosphate reductase subunit M1; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K10807 ribonucleoside-diphosphate reductase subunit M1; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K10807 ribonucleoside-diphosphate reductase subunit M1 |
| EC | 1.17.4.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.6198.1.S1_at
|
| Corresponding NCBI Gene | 816715 |
| Trichome-related Gene from Literature | N/A |