Detail of EST/Unigene BQ135876 |
Acc. | BQ135876 |
Internal Acc. | NF021F12EC1F1103 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase cytosolic isozyme OS=Medicago sativa E-value=4e-86; Glutamine synthetase nodule isozyme OS=Vigna aconitifolia E-value=5e-83; Glutamine synthetase cytosolic isozyme OS=Lotus japonicus E-value=5e-82; Glutamine synthetase OS=Nicotiana plumbaginifolia E-value=5e-82; Glutamine synthetase cytosolic isozyme 1-1 OS=Arabidopsis thaliana E-value=1e-81; |
Length | 814 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL (1 ESTs); |
Sequence | CTGATTCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | BQ135876 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.3145.1.S1_s_at
|
Corresponding NCBI Gene | 833738 |
Trichome-related Gene from Literature | N/A |