| Detail of EST/Unigene BQ138414 |
| Acc. | BQ138414 |
| Internal Acc. | NF003A11PH1F1083 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Aldehyde dehydrogenase OS=Alternaria alternata E-value=0; Aldehyde dehydrogenase OS=Davidiella tassiana E-value=0; Aldehyde dehydrogenase OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) E-value=7e-98; Aldehyde dehydrogenase OS=Aspergillus niger E-value=2e-95; Putative aldehyde dehydrogenase-like protein C9E9.09c OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=4e-83; |
| Length | 669 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA (1 ESTs); |
| Sequence | GCCATTGCCACCGGTAACACGGTTGTTCTGAAGACCGCTGAGCAGACTCCCCTCTCTGCC |
| EST members of Unigene | BQ138414 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00903 Limonene and pinene degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00631 1,2-Dichloroethane degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00053 Ascorbate and aldarate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Lipid Metab |
| EC | 1.2.1.3 1.2.1.36 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.34110.1.S1_at
|
| Corresponding NCBI Gene | 823955 |
| Trichome-related Gene from Literature | N/A |