Detail of EST/Unigene BQ138633 |
Acc. | BQ138633 |
Internal Acc. | NF005E04PH1F1034 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Hexokinase OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) E-value=9e-54; Hexokinase OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=2e-40; Hexokinase-1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=5e-37; Hexokinase-2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=8e-37; Hexokinase OS=Schwanniomyces occidentalis E-value=2e-36; |
Length | 646 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA (1 ESTs); |
Sequence | GCGTTATCTTTCCATCTCTGAACTTCTGGACGGATAATAGAAACACACCTGAGCTGTACC |
EST members of Unigene | BQ138633 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
EC | 2.7.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.6313.1.S1_at
|
Corresponding NCBI Gene | 829034 |
Trichome-related Gene from Literature | 829034 |