Detail of EST/Unigene BQ139044 |
Acc. | BQ139044 |
Internal Acc. | NF010C11PH1F1083 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=2e-98; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-96; Zeaxanthin epoxidase, chloroplastic OS=Capsicum annuum E-value=2e-96; Zeaxanthin epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=1e-95; Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-94; |
Length | 668 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA (1 ESTs); |
Sequence | TGCAATGGTATGCGTTTCACAAAGAAGCTCCCGGTGGTGCTGATGAACCGAATAAAAAAA |
EST members of Unigene | BQ139044 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34140.1.S1_at
|
Corresponding NCBI Gene | 836838 |
Trichome-related Gene from Literature | N/A |