| Detail of EST/Unigene BQ139044 |
| Acc. | BQ139044 |
| Internal Acc. | NF010C11PH1F1083 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=2e-98; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-96; Zeaxanthin epoxidase, chloroplastic OS=Capsicum annuum E-value=2e-96; Zeaxanthin epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=1e-95; Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-94; |
| Length | 668 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA (1 ESTs); |
| Sequence | TGCAATGGTATGCGTTTCACAAAGAAGCTCCCGGTGGTGCTGATGAACCGAATAAAAAAA |
| EST members of Unigene | BQ139044 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.34140.1.S1_at
|
| Corresponding NCBI Gene | 836838 |
| Trichome-related Gene from Literature | N/A |