Detail of EST/Unigene BQ140458 |
Acc. | BQ140458 |
Internal Acc. | NF035H09PH1F1080 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 3, mitochondrial OS=Glycine max E-value=5e-35; Alternative oxidase 2, mitochondrial OS=Glycine max E-value=7e-20; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=2e-17; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=4e-12; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=1e-11; |
Length | 384 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA (1 ESTs); |
Sequence | ATTTACATTCAACATGAGAAACATTTTATTAAGGTCAACTGCACGAGCTTTGTTCCGCAA |
EST members of Unigene | BQ140458 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.6352.1.S1_s_at
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |