| Detail of EST/Unigene BQ140771 |
| Acc. | BQ140771 |
| Internal Acc. | NF042H01PH1F1016 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase, peroxisomal OS=Yarrowia lipolytica (strain CLIB 122 / E 150) E-value=6e-16; 3-ketoacyl-CoA thiolase, peroxisomal OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=1e-09; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Candida tropicalis E-value=1e-09; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Candida tropicalis E-value=1e-09; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Rattus norvegicus E-value=3e-08; |
| Length | 349 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA (1 ESTs); |
| Sequence | GGCCAGAAGATCATCGGCAAGTTCGTGCAAGCCTCCATTGTCGGCGTGCCCCCTCTACTG |
| EST members of Unigene | BQ140771 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
| EC | 2.3.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.6358.1.S1_at
|
| Corresponding NCBI Gene | 834946 |
| Trichome-related Gene from Literature | N/A |