Detail of EST/Unigene BQ140913 |
Acc. | BQ140913 |
Internal Acc. | NF055A08PH1F1065 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Leucine aminopeptidase 2, chloroplastic OS=Solanum lycopersicum E-value=1e-28; Leucine aminopeptidase 1 OS=Arabidopsis thaliana E-value=8e-26; Leucine aminopeptidase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-25; Leucine aminopeptidase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-25; Leucine aminopeptidase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-23; |
Length | 642 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA (1 ESTs); |
Sequence | GCAACAAAAAATGTCAGGTGCAGCCTCCTCATCTACTATTCTCACTACTTCACTTGTATT |
EST members of Unigene | BQ140913 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.6362.1.S1_at
|
Corresponding NCBI Gene | 816954 |
Trichome-related Gene from Literature | N/A |