| Detail of EST/Unigene BQ140913 |
| Acc. | BQ140913 |
| Internal Acc. | NF055A08PH1F1065 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Leucine aminopeptidase 2, chloroplastic OS=Solanum lycopersicum E-value=1e-28; Leucine aminopeptidase 1 OS=Arabidopsis thaliana E-value=8e-26; Leucine aminopeptidase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-25; Leucine aminopeptidase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-25; Leucine aminopeptidase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-23; |
| Length | 642 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA (1 ESTs); |
| Sequence | GCAACAAAAAATGTCAGGTGCAGCCTCCTCATCTACTATTCTCACTACTTCACTTGTATT |
| EST members of Unigene | BQ140913 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.6362.1.S1_at
|
| Corresponding NCBI Gene | 816954 |
| Trichome-related Gene from Literature | N/A |