Detail of EST/Unigene BQ141345 |
Acc. | BQ141345 |
Internal Acc. | NF018E07PH1F1055 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit 9, mitochondrial OS=Ustilago maydis (strain 521 / FGSC 9021) E-value=2e-07; ATP synthase subunit 9, mitochondrial OS=Trichophyton rubrum E-value=7e-07; ATP synthase subunit 9, mitochondrial OS=Podospora anserina E-value=2e-06; ATP synthase subunit 9, mitochondrial OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=2e-06; |
Length | 419 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA (1 ESTs); |
Sequence | ACGACCAACACCATCACCATGGTTGCCATCGCTCGTTCCTTCGGCGCTGCCCGCGTGGCC |
EST members of Unigene | BQ141345 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.6374.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |