Detail of EST/Unigene BQ141780 |
Acc. | BQ141780 |
Internal Acc. | NF029G10IN1F1081 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=2e-18; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Arabidopsis thaliana E-value=5e-18; Oxygen-evolving enhancer protein 2, chloroplastic (Fragment) OS=Brassica juncea E-value=1e-16; Oxygen-evolving enhancer protein 2, chloroplastic OS=Sinapis alba E-value=3e-16; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=1e-15; |
Length | 855 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (1 ESTs); |
Sequence | ATTATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACC |
EST members of Unigene | BQ141780 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34259.1.S1_at
|
Corresponding NCBI Gene | 837178 |
Trichome-related Gene from Literature | N/A |