Detail of EST/Unigene BQ143741 |
Acc. | BQ143741 |
Internal Acc. | NF006G07DT1F1053 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase nodule isozyme OS=Medicago sativa E-value=1e-20; Glutamine synthetase cytosolic isozyme 1-3 OS=Oryza sativa subsp. japonica E-value=9e-20; Glutamine synthetase OS=Alnus glutinosa E-value=1e-19; Glutamine synthetase cytosolic isozyme OS=Pinus sylvestris E-value=2e-19; Glutamine synthetase N-1 OS=Phaseolus vulgaris E-value=4e-19; |
Length | 906 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | GCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGC |
EST members of Unigene | BQ143741 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10422.1.S1_at
|
Corresponding NCBI Gene | 842935 |
Trichome-related Gene from Literature | N/A |