| Detail of EST/Unigene BQ143772 |
| Acc. | BQ143772 |
| Internal Acc. | NF048B02DT1F1014 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Lon protease homolog 2, peroxisomal OS=Spinacia oleracea E-value=1e-19; Lon protease homolog 2, peroxisomal OS=Arabidopsis thaliana E-value=5e-16; Lon protease homolog 2, peroxisomal OS=Zea mays E-value=1e-06; Lon protease homolog 2, peroxisomal OS=Oryza sativa subsp. japonica E-value=2e-06; Lon protease homolog 2, peroxisomal OS=Oryza sativa subsp. indica E-value=2e-06; |
| Length | 790 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (1 ESTs); |
| Sequence | TGATACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
| EST members of Unigene | BQ143772 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.34278.1.S1_at
|
| Corresponding NCBI Gene | 834750 |
| Trichome-related Gene from Literature | N/A |