Detail of EST/Unigene BQ144169 |
Acc. | BQ144169 |
Internal Acc. | NF051E10DT1F1083 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Methionine--tRNA ligase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=8e-45; Methionine--tRNA ligase OS=Thermosynechococcus elongatus (strain BP-1) E-value=9e-37; Methionine--tRNA ligase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=2e-36; Methionine--tRNA ligase OS=Enterococcus faecalis (strain ATCC 700802 / V583) E-value=5e-23; Methionine--tRNA ligase OS=Mycobacterium leprae (strain TN) E-value=1e-22; |
Length | 828 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | TTATTCGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGG |
EST members of Unigene | BQ144169 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01874 methionyl-tRNA synthetase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01874 methionyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01874 methionyl-tRNA synthetase |
EC | 6.1.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.13474.1.S1_at
|
Corresponding NCBI Gene | 824706 |
Trichome-related Gene from Literature | N/A |