| Detail of EST/Unigene BQ144316 |
| Acc. | BQ144316 |
| Internal Acc. | NF066B10DT1F1080 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L12, chloroplastic OS=Nicotiana tabacum E-value=1e-21; 50S ribosomal protein L12, chloroplastic OS=Nicotiana sylvestris E-value=1e-21; 50S ribosomal protein L12, chloroplastic OS=Spinacia oleracea E-value=3e-20; 50S ribosomal protein L12, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-19; 50S ribosomal protein L12-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-18; |
| Length | 807 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (1 ESTs); |
| Sequence | TGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | BQ144316 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40093.1.S1_at
|
| Corresponding NCBI Gene | 822403 |
| Trichome-related Gene from Literature | N/A |