Detail of EST/Unigene BQ144316 |
Acc. | BQ144316 |
Internal Acc. | NF066B10DT1F1080 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L12, chloroplastic OS=Nicotiana tabacum E-value=1e-21; 50S ribosomal protein L12, chloroplastic OS=Nicotiana sylvestris E-value=1e-21; 50S ribosomal protein L12, chloroplastic OS=Spinacia oleracea E-value=3e-20; 50S ribosomal protein L12, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-19; 50S ribosomal protein L12-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-18; |
Length | 807 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | TGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BQ144316 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40093.1.S1_at
|
Corresponding NCBI Gene | 822403 |
Trichome-related Gene from Literature | N/A |