Detail of EST/Unigene BQ144644 |
Acc. | BQ144644 |
Internal Acc. | NF075G05DT1F1039 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=7e-36; Chaperonin 60 subunit beta 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-34; RuBisCO large subunit-binding protein subunit beta, chloroplastic (Fragment) OS=Secale cereale E-value=2e-34; Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=9e-34; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Brassica napus E-value=9e-34; |
Length | 705 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | GCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGG |
EST members of Unigene | BQ144644 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34373.1.S1_s_at
|
Corresponding NCBI Gene | 835751 |
Trichome-related Gene from Literature | N/A |