Detail of EST/Unigene BQ145109 |
Acc. | BQ145109 |
Internal Acc. | NF036B02DT1F1025 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Early light-induced protein, chloroplastic OS=Pisum sativum E-value=7e-26; Desiccation stress protein DSP-22, chloroplastic OS=Craterostigma plantagineum E-value=3e-18; High molecular mass early light-inducible protein HV58, chloroplastic OS=Hordeum vulgare E-value=2e-17; Low molecular mass early light-inducible protein HV60, chloroplastic OS=Hordeum vulgare E-value=8e-17; Low molecular mass early light-inducible protein HV90, chloroplastic OS=Hordeum vulgare E-value=2e-16; |
Length | 677 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | GCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCG |
EST members of Unigene | BQ145109 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10457.1.S1_at
|
Corresponding NCBI Gene | 821855 |
Trichome-related Gene from Literature | N/A |