Detail of EST/Unigene BQ146543 |
Acc. | BQ146543 |
Internal Acc. | NF002D04FL1F1042 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit VI, chloroplastic OS=Brassica rapa E-value=5e-38; Photosystem I reaction center subunit VI-2, chloroplastic OS=Arabidopsis thaliana E-value=3e-37; Photosystem I reaction center subunit VI, chloroplastic OS=Spinacia oleracea E-value=6e-37; Photosystem I reaction center subunit VI-1, chloroplastic OS=Arabidopsis thaliana E-value=4e-36; Photosystem I reaction center subunit VI, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-32; |
Length | 623 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER (1 ESTs); |
Sequence | TGATTACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | BQ146543 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42999.1.S1_at
|
Corresponding NCBI Gene | 841653 |
Trichome-related Gene from Literature | N/A |