Detail of EST/Unigene BQ146582 |
Acc. | BQ146582 |
Internal Acc. | NF013G05FL1F1039 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-70; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=3e-70; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-70; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-69; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-69; |
Length | 785 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER (1 ESTs); |
Sequence | TGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
EST members of Unigene | BQ146582 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37209.1.S1_s_at
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |