| Detail of EST/Unigene BQ147713 |
| Acc. | BQ147713 |
| Internal Acc. | NF045H02FL1F1027 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable histone acetyltransferase HAC-like 1 OS=Oryza sativa subsp. japonica E-value=2e-72; Histone acetyltransferase HAC12 OS=Arabidopsis thaliana E-value=1e-70; Histone acetyltransferase HAC5 OS=Arabidopsis thaliana E-value=4e-70; Histone acetyltransferase HAC1 OS=Arabidopsis thaliana E-value=1e-69; Histone acetyltransferase HAC4 OS=Arabidopsis thaliana E-value=3e-68; |
| Length | 653 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER (1 ESTs); |
| Sequence | CAGAAAGTCTTTCTATTAGAGAAGTGTTATCTGTCGACAAACAATTGAAAGTGAATAAGC |
| EST members of Unigene | BQ147713 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04498 E1A/CREB-binding protein |
| EC | 2.3.1.48 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.34429.1.S1_at
|
| Corresponding NCBI Gene | 838242 |
| Trichome-related Gene from Literature | N/A |