Detail of EST/Unigene BQ148323 |
Acc. | BQ148323 |
Internal Acc. | NF067A11FL1F1085 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable aminotransferase ACS10 OS=Arabidopsis thaliana E-value=5e-68; Probable aminotransferase ACS12 OS=Arabidopsis thaliana E-value=1e-60; 1-aminocyclopropane-1-carboxylate synthase 8 OS=Arabidopsis thaliana E-value=4e-51; 1-aminocyclopropane-1-carboxylate synthase 7 OS=Arabidopsis thaliana E-value=6e-51; 1-aminocyclopropane-1-carboxylate synthase 3 OS=Solanum lycopersicum E-value=1e-49; |
Length | 660 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER (1 ESTs); |
Sequence | CTGCCTAGCAGATAATGGAAATGCATTCCTTGTTCCCACGCCTCATAGTCCTGGCTTTGA |
EST members of Unigene | BQ148323 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
EC | 2.6.1.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34453.1.S1_at
|
Corresponding NCBI Gene | 842598 |
Trichome-related Gene from Literature | N/A |