| Detail of EST/Unigene BQ148608 |
| Acc. | BQ148608 |
| Internal Acc. | NF078F03FL1F1029 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Lipoxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=5e-27; Linoleate 13S-lipoxygenase 3-1, chloroplastic OS=Solanum tuberosum E-value=4e-26; Lipoxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=5e-26; Lipoxygenase 6, choloroplastic OS=Arabidopsis thaliana E-value=3e-21; Probable lipoxygenase 6 OS=Oryza sativa subsp. japonica E-value=4e-21; |
| Length | 311 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER (1 ESTs); |
| Sequence | TGCCGATCTTAAAAGAAGAGGTTTGGCGGTTCCAGATGCCACCTCGGCCACATGGCATTA |
| EST members of Unigene | BQ148608 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.13.11.- 1.13.11.33 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.6540.1.S1_at
|
| Corresponding NCBI Gene | 843584 |
| Trichome-related Gene from Literature | N/A |