Detail of EST/Unigene BQ148749 |
Acc. | BQ148749 |
Internal Acc. | NF082B12FL1F1096 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain 3A, chloroplastic OS=Pisum sativum E-value=2e-46; Ribulose bisphosphate carboxylase small chain 3C, chloroplastic OS=Pisum sativum E-value=2e-46; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=4e-44; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Glycine tomentella E-value=4e-42; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Glycine tabacina E-value=4e-42; |
Length | 726 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER (1 ESTs); |
Sequence | TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BQ148749 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.12202.1.S1_at
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |