Detail of EST/Unigene BQ149843 |
Acc. | BQ149843 |
Internal Acc. | NF010C01FL1F1006 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Pisum sativum E-value=9e-15; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Antirrhinum majus E-value=7e-13; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Mesembryanthemum crystallinum E-value=1e-12; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Sinapis alba E-value=3e-12; Glyceraldehyde-3-phosphate dehydrogenase OS=Dictyostelium discoideum E-value=4e-12; |
Length | 706 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER (1 ESTs); |
Sequence | TGATACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGG |
EST members of Unigene | BQ149843 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.2.1.12 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819567 |
Trichome-related Gene from Literature | 819567 |