| Detail of EST/Unigene BQ150029 |
| Acc. | BQ150029 |
| Internal Acc. | NF001G06LF1F1051 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-53; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=9e-53; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-52; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-52; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=2e-52; |
| Length | 791 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (1 ESTs); |
| Sequence | TGATACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGG |
| EST members of Unigene | BQ150029 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |