Detail of EST/Unigene BQ150029 |
Acc. | BQ150029 |
Internal Acc. | NF001G06LF1F1051 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-53; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=9e-53; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-52; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-52; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=2e-52; |
Length | 791 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | TGATACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGG |
EST members of Unigene | BQ150029 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |