Detail of EST/Unigene BQ150461 |
Acc. | BQ150461 |
Internal Acc. | NF028B04LF1F1029 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=1e-18; Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum E-value=5e-18; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=1e-09; Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=1e-09; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-09; |
Length | 894 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | CTGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACC |
EST members of Unigene | BQ150461 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10343.1.S1_at
|
Corresponding NCBI Gene | 842446 |
Trichome-related Gene from Literature | N/A |