| Detail of EST/Unigene BQ150461 |
| Acc. | BQ150461 |
| Internal Acc. | NF028B04LF1F1029 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=1e-18; Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum E-value=5e-18; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=1e-09; Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=1e-09; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-09; |
| Length | 894 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (1 ESTs); |
| Sequence | CTGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACC |
| EST members of Unigene | BQ150461 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10343.1.S1_at
|
| Corresponding NCBI Gene | 842446 |
| Trichome-related Gene from Literature | N/A |